Skip to main content
Download PDF

Maximizing horizontal transmission through mating: increased mating frequency and mating competitiveness associated with Microsporidia MB-infected Anopheles arabiensis males

Malaria Journal volume 24, Article number: 114 (2025) Cite this article

Abstract

Background

Microsporidia MB is a naturally occurring symbiont in Anopheles arabiensis mosquitoes that inhibits the development of Plasmodium. It is transmitted both vertically and horizontally, enabling its spread within mosquito populations. Currently, mating is the only known mechanism for horizontal transmission. Understanding the factors that influence Microsporidia MB transmission during mating is crucial for developing a malaria transmission-blocking strategy based on this symbiont.

Methods

The effect of mosquito age on Microsporidia MB transmission was determined through mating bioassays between infected and uninfected Anopheles arabiensis males and females in three age groups: 3–4 days, 7–8 days, and 10–11 days. Mating bioassays were also conducted to determine if Microsporidia MB infection affects the individual male mating frequencies and mating competitiveness of male mosquitoes. To assess the effect of Microsporidia MB-infection on swarming under field conditions, swarming and non-swarming An. arabiensis male mosquitoes were collected and compared for Microsporidia MB prevalence.

Results

The age of mosquitoes does not affect the transmission of Microsporidia MB from males to females (χ2 = 11.6, df = 12, p = 0.47). However, transmission of the Microsporidia MB from female mosquitoes to males was not observed in the 3–4 days old age group. Although heterogeneous, there is higher overall transmission from male to female (41.5%) compared to female to male (22.4%). When individual males (Microsporidia MB infected or uninfected) were mated with females, Microsporidia MB-infected males on average mated two times more than the Microsporidia MB-uninfected F1 male mates from the age of 3–4 days to death (t = 2.2, df = 56.8, p = 0.03). Also, Microsporidia MB-infected males when combined in a cage with Microsporidia MB uninfected males were twice as competitive (χ2 = 4.74, df = 1, p = 0.02) to the uninfected males in mating with uninfected females. In natural swarms, the proportion of Microsporidia MB-infected males was significantly higher compared to the non-swarming male mosquitoes (χ2 = 685.5, df = 1, p < 0.0001).

Conclusion

There is a moderate, although heterogenous, horizontal transmission of Microsporidia MB across all age groups, except from 3–4 days old, infected females to males. Microsporidia MB-infected male mosquitoes were almost twice as competitive in mating as their uninfected counterparts. Therefore, Microsporidia MB infected males can potentially disseminate Microsporidia MB in the natural mosquito populations, thus, contributing to malaria control. However, semi-field studies are required to validate these results in a natural environment.

Background

Malaria-endemic countries reported an estimated 249 million cases of malaria globally in 2022 [1]. This figure is 55% higher than the target level set by the 2025 Global Technical Strategy for malaria [2, 3]. While there is ongoing discussion about the accuracy of these estimates, it is widely acknowledged that the progress in malaria control has stalled [4, 5]. Factors like climate change and the spread of Anopheles stephensi in Africa are expected to exacerbate the situation, compounding existing challenges such as drug and insecticide resistance [1, 6, 7]. Consequently, there is an urgent need to enhance the current strategies and develop new approaches to control malaria [8].

Microsporidia MB, a natural symbiont of Anopheles mosquitoes, has been shown to block Plasmodium transmission without affecting the fitness of the mosquito host [9,10,11,12]. Microsporidia MB spreads both vertically—from mother to offspring—and horizontally through mating, enabling it to propagate throughout the mosquito populations [9, 11, 13]. These traits make Microsporidia MB a promising target for blocking malaria transmission [14]. Currently, there is no technique available to culture Microsporidia MB spores. Therefore, releasing Microsporidia MB-infected mosquitoes that have vertically inherited Microsporidia MB from their mothers through mass-rearing in the laboratory, is currently the most likely application scenario to spread Microsporidia MB in wild mosquito populations. Although mosquito releases have been controversial due to various issues including community concerns in the past, recent efforts in Africa, supported by increased community engagement, have made them possible [15,16,17,18,19,20]. This has resulted in the successful release of genetically modified mosquitoes in Burkina Faso and Djibouti [16, 21,22,23]. In a recent study, 81% of the household heads interviewed expressed a willingness to accept, and 96% were willing to participate in a Microsporidia MB-based strategy involving mosquito release [24].

The success of Microsporidia MB-infected mosquito release relies on the rate at which Microsporida MB is transmitted through the wild mosquito populations. High vertical transmission rates have been recorded in the laboratory from field-collected, blood-fed mosquitoes to the offspring [9,10,11]. The average vertical transmission from infected field-collected Anopheles arabiensis females was reported to be approximately 97% [25]. Similarly, field-collected Anopheles gambiae sensu stricto (s.s.) females transmitted Microsporidia MB infection to their progeny at rates ranging from 0 to 100% across 12 isofemale lines, and from 28.6% to 85.3% in pooled lines [11]. To date, mating remains the only known method for horizontal transmission of Microsporidia MB in mosquitoes, with generally higher transmission rates reported from infected males to uninfected females than from infected females to uninfected males [13].

Previous studies using virgin An. gambiae s.s. males that were infected with Microsporidia MB to study experimental transmission of symbiont demonstrated successful transmission to at least one female in 36% of cages (4 out of 11) [11]. In contrast, infected An. gambiae s.s. females only transmitted the infection to at least one male in 11% of cages (1 out of 9) [11]. A similar pattern of lower female-to-male transmission was noted in An. arabiensis, where transmission was confirmed in 56% of cages (9 out of 16) with infected males and uninfected females, compared to 33% (5 out of 15) of cages with infected females and uninfected males [13]. These observed modes of vertical and horizontal transmissions are supported by the localization of Microsporidia MB in the testis and ovaries [13, 26]. Microsporidia MB, when present, appears to be the predominant reproductive eukaryotic microbe in An. arabiensis owing to its occurrence in high densities in the gonads as shown by light microscopy [26, 27]. However, it has been shown that the density of Microsporidia MB in the gonads and ovaries significantly decreased with mosquito age, with females losing Microsporidia MB already between the age of 2–14 days, while in males the decrease was only observed between 7 and 14 days [26]. The effect of male and female mosquito age on horizontal transmission of Microsporidia MB is not well understood at present.

Anopheles female mosquitoes tend to mate once and at an early stage of their adult life, while male mosquitoes can mate more than once [28]. Moderate to large body size of males is associated with higher mating success [29,30,31]. Similarly, the bigger body size of females is also associated with a higher probability of being inseminated [32]. However, parasites and symbionts can influence the mating success of the infected host. In the case of parasites, many species of females avoid mating with males with transmittable parasites to prevent acquiring infections and to ensure that the future progeny is not affected by the negative physiological effects of a parasite-infected parent [33,34,35,36]. In the case of symbionts, it is expected that the females will prefer males that are infected with symbionts. However, the evidence of female preference for symbiont-infected males is scanty. Studies carried out with Wolbachia, a symbiotic bacteria, showed that males infected by the benign wMel Wolbachia strain, or the virulent wMelPop (popcorn) strain were equally competitive in mating with females like the uninfected males [31]. However, Wolbachia and other symbionts, such as Rickettsia, Spiroplasma, spread through mechanisms that affect host sex ratio, sex allocation, or sexuality [37]. Microsporidia MB, on the other hand, has no negative fitness effects on the sex and does not distort the sex ratio [9].

In the initial stages following the release of Microsporidia MB-infected mosquitoes, the spread of Microsporidia MB infection in the wild mosquito populations will rely on the success of mating between the released laboratory colonies and the wild mosquitoes. Therefore, in this study, the aim was to understand the factors that could influence Microsporidia MB transmission and whether Microspridia MB infection impacts male mating frequency and competitiveness. Specifically, the; (i) effect of male and female age on Microsporidia MB transmission, (ii) effect of Microsporidia MB infection on male mating frequency and competitiveness, and (iii) prevalence of Microsporidia MB infected males in natural swarms. The key findings of this study will offer valuable insights to inform future research, including the theoretical models used to design a Microsporidia MB-based application strategy. Additionally, they will enhance understanding of strictly symbiont-mediated sexual selection.

Methods

Mosquito collection and processing

Indoor resting gravid Anopheles female mosquitoes were collected using a manual aspirator from houses near the Ahero irrigation scheme (− 34.9190 W,− 0.1661 N), Kisumu County. At this site, An. gambiae sensu lato (s.l.) is reported to be the most abundant [38], with > 97% of the complex members being identified as An. arabiensis. The mosquito collections were kept in cages (30 cm × 30 cm × 30 cm) for transportation to the insectary at the International Centre for Insect Physiology and Ecology-Thomas Odhiambo Campus (iTOC-Mbita, Homa Bay County). To minimize mosquito mortality, the cages were covered with wet towels to maintain high humidity levels and mosquitoes had access to 6% glucose. At the insectary, each gravid female mosquito was placed in a 1.5 ml microcentrifuge tube, containing a strip of wet Whatman paper, to force oviposition [39]. The mosquitoes that oviposited were morphologically identified.

DNA extraction and molecular identification of mosquitoes

Total DNA was isolated from mosquito samples and purified using the protein precipitate method (Puregene, Qiagen, Netherlands) [9]. DNA samples were stored at − 20 °C for short-term storage and − 80 °C for long-term storage. A molecular assay based on the SINE S200 × 6.1 locus was used to differentiate between An. gambiae s.s. and An. arabiensis [40]. All experiments were carried out using F1 offspring from females who were identified as An. arabiensis.

Molecular detection and quantification of microsporidia MB in mosquitoes

Field-collected female mosquitoes identified morphologically as An. gambiae s.l. were further identified using molecular techniques as An. arabiensis through molecular identification and mosquitoes harvested after experiments were screened for Microsporidia MB with qPCR. A 10 μl final PCR reaction volume was used consisting of 2 µl HOTFirepol® Blend Master Mix Ready-To-Load (Solis Biodyne, Estonia, mix composition: 7.5 mM magnesium chloride, 2 mM of each dNTPs, HOT FIREPol® DNA polymerase), 0.5 µl of 5 pmol µl−1 of both forward and reverse primers (MB18SF: CGCCGGCCGTGAAAAATTTA and MB18SR: CCTTGGACGTGGGAGCTATC), 2 µl of the template and 5 µl nuclease-free PCR water. PCR thermocycling conditions were as follows: initial denaturation at 95 °C for 15 min, denaturation at 95 °C for 1 min, followed by annealing at 62 °C for 90 s and extension at 72 °C for a further 60 s, all done for 35 cycles. Final elongation was done at 72 °C for 5 min. The scores and densities were normalized against the Anopheles ribosomal S7 host gene S7 F: TCCTGGAGCTGGAGATGAAC and S7R: GACGGGTCTGTACCTTCTGG) [41]. Samples were considered negative if the cycle threshold was greater than 30 and if the melt curve did not align with the positive control melt curve. All reactions were done using a Mic qPCR cycler (Biomolecular Systems, Australia).

Rearing F1 mosquito progeny

All larval offsprings of Microsporidia MB-infected female mosquitoes were reared together to establish an infected line. Similarly, a Microsporidia MB negative isogroup line was also established. The larvae were reared under ambient semi-field conditions and fed on Tetramin™ baby fish food daily. The pupae that developed from the larvae were sexed as males and females based on their genital lobes under a microscope and then transferred to holding cages, designated for males or females (15 cm × 15 cm × 15 cm), in small cups with water. The adult mosquitoes that emerged from the pupae in the holding cages were maintained on 6% glucose. These adults, F1 progeny of Microsporidia MB positive and negative females, and insectary An. arabiensis mosquitoes obtained from the insectary at the International Centre for Insect Physiology and Ecology (icipe)-Thomas Odhiambo Campus were used for the experiments. As vertical transmission from mother to offspring is not 100% [9], the F1 from Microsporidia MB positive line were screened for Microsporidia MB presence after the experiment ended to determine if they were positive or negative for Microsporidia MB.

Wing length measurement

The body size of male and female mosquitoes is associated with successful swarming and reproductive success [29,30,31,32]. To adjust for any difference in body size of the F1 mosquitoes, wing length used as a proxy for body size, was measured for all the mosquitoes [42, 43]. Before measurements, the mosquitoes were immobilized on ice and then the right wing was carefully detached from the thorax. The ventral side of the wing was measured in millimeters from the notch of the alula to the wing tip using a Dino-lite handheld digital microscope (Model AM4113ZT, Huatang Optical Industry Co., Taiwan).

Dissection to determine mating status in female mosquitoes

To determine if the experimental female mosquitoes had mated, their spermatheca was dissected. Each female was placed on a slide under a microscope (MOTIC SMZ- 140-N2GG model) and a drop of 1 × Phosphate Buffer Solution (1 × PBS) was added. The microscope was focused until a clear image of the mosquito was observed. Dissecting needles were used to nip the second abdominal segment from the bottom on both sides and then carefully ripped apart from the rest of the body. The presence or absence of sperms in each spermatheca was recorded. A spermathecae with sperms appeared translucent and indicated that the female mosquito had mated and a spermatheca without sperms appeared “transparent” and indicated that the female mosquito had not mated [44].

The effect of age on horizontal transmission of Microsporidia MB in An. arabiensis

To determine the effect of age on Microsporidia MB transmission, virgin males and females were crossed from either of the three age groups: 3–4 days, 7–8 days, and 10–11 days. Control crosses consisted of males and females An. arabiensis mosquitoes from the insectary. Experimental crosses consisted of F1 males (mates) from Microsporidia MB infected line with insectary females (recipients) for male-to-female transmission and F1 females (mates) from Microsporidia MB infected line with insectary males (recipients) for female-to-male transmission (Table 1). Each cross was replicated at least three times. The sample size per replicate ranged between 18–40 mosquitoes due to the availability of F1 mosquitoes. However, each replicate consisted of males and females combined in an approximately 1:1 ratio. The male and female mosquitoes were combined for 3 days during which they had access to a 6% glucose solution. After this period the mosquitoes were harvested, the wing length of all the mosquitoes was measured, female mosquitoes were dissected to determine their mating status, and all the mosquitoes in the experimental crosses were screened for Microsporidia MB, as described above.

Table 1 Overview of crosses to determine the effect of age on horizontal transmission of Microsporidia MB in An. arabiensis mosquitoes. Microsporidia MB-negative insectary mosquitoes (recipients) were crossed with Microsporidia MB-positive F1 mosquitoes (mates)
Full size table

Comparing the mating frequency of Microsporidia MB infected and uninfected males

Male Anopheles mosquitoes can mate more than one time; therefore the experiment was designed to enable measuring the mating frequency of each male mosquito. One 3–4 days old virgin male mosquito, either Microsporidia MB-infected or Microsporidia MB-uninfected F1 male, was placed together with three 3–4 days old virgin insectary female mosquitoes in a paper cup for three days. After three days, the females were removed and another batch of three 3–4 days old virgin females was added. This was repeated until the male mosquito died. All mosquitoes had ad libitum access to 6% glucose solution. The experiment was replicated with male mosquitoes that were the progeny of females collected at different times. Wing length was measured for all the dead males. The females were dissected to determine if the female had mated or not. All mosquitoes were screened for the molecular detection and quantification of Microsporidia MB.

Comparing the mating competitiveness of Microsporidia MB-infected and uninfected males

To compare the mating competitiveness of Microsporidia MB infected and uninfected F1 males directly, male mosquitoes were combined in the same cage with the uninfected female insectary mosquitoes. A fluorescent dye Rhodamine B was used to differentiate between Microsporidia MB-infected and uninfected males [45]. Preliminary experiments were conducted to determine the optimal concentration of the dye that would be detectable in the male for over 7 days and transfer from males to the females on mating. The 0.2% Rhodamine B dye (w/v) in 6% glucose was found to be the optimal concentration. To adjust for any potential effect of Rhodamine B on mating competitiveness, two sets of experiments were conducted: (a) 10 Microsporidia MB infected males were fed on Rhodamine B and combined with 10 uninfected males and 20 uninfected females, (b) 10 Microsporidia MB uninfected males were fed on Rhodamine B and combined with 10 infected males and 20 uninfected females. The mosquitoes were maintained on 6% glucose and harvested after 3 days. The wing length of the harvested mosquitoes was measured. The females were dissected to determine their mating status and presence of dye in their spermatheca under the microscope (Carl Zeiss Suzhou Co., Ltd., Suzhou, China mounted with NightSEA green filters (SFA-LFS-GR) (Electron Microscopy Sciences, Hatfield, PA). Undissected male mosquitoes were observed under a microscope for Rhodamine B dye absence or presence and screened to confirm the Microsporidia MB infection. The experiment was replicated five times each with Rhodamine B-fed Microsporidia MB-infected mosquitoes and Rhodamine B-fed uninfected mosquitoes.

Comparing the proportion of Microsporidia MB-infected males in swarming mosquitoes and those caught outside swarms

The collection of male mosquitoes from swarms and outside swarms were done in Ahero, near the Ahero irrigation scheme (− 34.9190 W, − 0.1661 N), Kisumu County. A preliminary survey was conducted to identify the swarming sites and timings. The collection was done daily for two weeks in July 2023. The swarming started at approximately 1840 h and lasted for approximately 30 min. Once the swarming started, a sweep net (15 cm in diameter and 30 cm deep with a wooden handle that was adjusted according to the swarm height) was used to catch the swarming mosquitoes by sweeping multiple times through the swarm until the swarming stopped, or until it was too dark to see the swarm. The mosquitoes collected were knocked out using ethyl acetate and the mosquitoes were separated as males and females and placed individually into labelled 1.5 ml Eppendorf tubes. In the laboratory, the wing length of each mosquito was measured, and all female mosquitoes were dissected to check for the absence or presence of sperms in their spermathecae. All mosquitoes identified morphologically as An. gambiae s.l. were identified to species level with PCR and screened to detect and quantify Microsporidia MB at the icipe-Thomas Odhiambo campus (Homa Bay County). Eight CDC Miniature Light Traps (model 512) were used for indoor and outdoor collection of males outside swarms. Trapping was done in eight houses; four houses had the traps hung outdoors from the eaves and four had traps hung indoors. The traps were set for a 12 h duration, from 1800 tO 0600 h every day for two weeks. The collections were done in locations near and on the same days as the swarm collection. The mosquitoes were then morphologically identified, and An. gambiae s.l. males were placed individually in labeled Eppendorf tubes. Following wing length measurement, the males were screened to detect and quantify Microsporidia MB and identify mosquito species at the icipe- Thomas Odhiambo campus.

Data analysis

All statistical tests were performed on version 8.0c software and R (version 4.3.2). The replicates of the age group and mating competitiveness experiment that were found to have no Microsporidia MB-infected F1 male or female mosquitoes after screening were not included in the analysis. Similarly, replicates of the mating frequency experiments where F1 male mosquitoes were Microsporidia MB-uninfected were also not included in the data analysis. Wing lengths were compared with ANOVA. Age groups were compared separately and combined to estimate the overall transmission rate. The transmission rate was a measure of the ability of Microsporidia MB to transmit itself and not the absolute transmission. The transmission rate was considered a 100% if every mating with an infected donor leads to Microsporidia MB transmission to the recipient (Additional file 1 Age group). The transmission rate (%) was calculated as follows:

$$Observed \,\,transmission \,\,rate \left(\%\right)=\frac{O}{E} \times 100$$

where O is the number of recipients that acquired the infection through mating and E is the expected number of acquired infections if the transmission rate is 100% calculated as a product of the proportion of F1 mates/females that were Microsporidia MB-infected and the confirmed number of matings per cage. The mating rate of female mosquitoes was calculated as:

$$Female \,mating \,rate \left(\%\right)=\frac{The \,number \,of \,females \,confirmed \,mated}{Total \,number \,of \,females \,in \,the \,cage}\times 100$$

Linear regression analysis was used to determine if there is a correlation between: i) the Microsporidia MB density in the recipient mosquito (predictor variable) and the Microsporidia MB density in the potential donor mate (response variable), ii) the Microsporidia MB density of the donor mates in crosses where transmission occurred (predictor variable) and Microsporidia MB density in donor mates where transmission did not occur (response variable), and iii) Microsporidia MB density of the male (predictor variable) and the number of times the male mosquito mated (response variable), in the mating frequency experiment.

The number of times Microsporidia MB-infected or Microsporidia MB-uninfected males mated from when they were 3–4 days old to death was compared with a t-test. The proportion of male mosquitoes that mated different number of times, were compared with the Chi-square test. Mating competitiveness was, also, compared with the Chi-square test with the proportion of females that mated with Microsporidia MB-infected or uninfected males. Wing lengths were compared with a t-test if there were two groups and ANOVA if there were more than two (2) groups. The proportions of Microsporidia MB-infected male mosquitoes caught from swarms and outside swarms were compared with the Chi-square test. Statistical significance level was set at α = 0.05.

Results

Horizontal transmission of Microsporidia MB occurs across age groups

Microsporidia MB was horizontally transmitted from male to female and from female to male (Table 2). The observed transmission was heterogenous and although the trend indicates a higher overall transmission (%) from male to female (41.5% ± 16.9) compared to female to male (22.4% ± 12.4), it was insignificant (χ2 = 9.1, df = 9, p = 0.42) (Additional file 1_Age group). The Microsporidia MB density in the donor mosquitoes was not different in males (R = 0.1, F = 0.2, p = 0.6) or females (R = 0.2, F = 0.3, p = 0.6) in experiments where transmission occurred or did not occur. The observed transmission rate from males to females was similar across all age groups; there was no significant difference in transmission between mosquitoes of ages 3–4 days old, 7–8 days old, and 10–11 days old (χ2 = 11.6, df = 12, p = 0.47). Similarly, the observed transmission rate was similar across two age groups for female-to-male crosses; there was no significant difference in transmission between mosquitoes of ages 7–8 days old, and 10–11 days old (χ2 = 2.9, df = 3, p = 0.41). However, no transmission was observed from 3 to 4 days-old females to males. The mating rate or mosquito body size did not affect the reported transmission rates as there was no difference in male wing length (F = 0.7, df = 2, p = 0.5) and female wing length (F = 1.65, df = 2, p = 0.2) or female mating rate (χ2 = 14, df = 14, p = 0.43) across age groups (Table 2). Due to few transmissions, data was combined across age groups to determine the correlation between the Microsporidia MB density in the donor and recipient mosquitoes. In male-to-female crosses, no correlation was found between the Microsporidia MB density in the potential donor male and the recipient female (R = 0.1, F = 0.1, p = 0.7). However, in female-to-male crosses, the higher Microsporidia MB density in potential female donors was positively associated with higher Microsporidia MB density in recipient males (R = 0.98, F = 68.5, p = 0.01) (Fig. 1).

Table 2 Average mating rate (%), average wing length (S.D.), and observed Microsporidia MB transmission rate (%) in mosquito mating pairs (Microsporidia MB-infected F1 and uninfected insectary) in different age groups
Full size table
Fig. 1
figure 1

Correlation between the Microsporidia MB density in the donor and the recipient, combined for all age group in a male to female and b female to male transmissions

Full size image

Mating frequency of Microsporidia MB-infected and uninfected males

Microsporidia MB-infected males mated almost twice as much as Microsporidia MB-uninfected F1 males. On average Microsporidia MB-infected males mated 1.7 (S.E. = 0.25) times and Microsporidia MB-uninfected F1 males mated 1 (S.E. = 0.19) time between the age of 3–4 days old and death (t = 2.2, df = 56.8, p = 0.03). A significantly higher proportion of Microsporidia MB-infected males mated 3–4 times compared to Microsporidia MB-uninfected males (χ2 = 4.69, df = 1, p = 0.03) (Fig. 2). Only one Microsporidia MB-infected male mated in round 6 (estimated age during the 6 th round, 21–24 days) of the experiment. Microsporidia MB-uninfected males mated only up to round 5 (estimated age during the 5 th round, 18–21 days) (Additional file 2_Mating rate). No correlation was found between the Microsporidia MB density and the number of times Microsporidia MB-infected males mated (R = 0.1, F = 0.8, p = 0.4).

Fig. 2
figure 2

The percentage of Microsporidia MB-infected males (n = 31) and Microsporidia MB-uninfected males (n = 31) mating different numbers of times between the age of 3–4 days old to death

Full size image

Mating competitiveness of Microsporidia MB-infected and uninfected male mosquitoes

Almost twice the females (Average proportion: 0.3 vs 0.13) mated with Microsporidia MB-infected male mosquitoes fed on Rhodamine B than uninfected males (χ2 = 3.13, df = 1, p = 0.07), but this was not significant (Fig. 3a; Additional file 3 Mating competitiveness). Higher mating competitiveness was also observed for Microsporidia MB-infected when uninfected mosquitoes were fed on Rhodamine B instead of Microsporidia MB-infected (Fig. 3b) (χ2 = 5.76, df = 1, p = 0.01). Comparing Microsporidia MB-infected and uninfected male mosquitoes, irrespective of which group was fed on Rhodamine B also showed twice the mating competitiveness (χ2 = 8.45, df = 1, p = 0.004) of Microsporidia MB-infected male mosquitoes (Fig. 3c). The wing lengths of Microsporidia MB-infected and uninfected male mosquitoes were not significantly different (t = − 0.6, df = 140, p = 0.5). Similarly, the wing lengths of females that mated with the Microsporidia MB-infected and uninfected male mosquitoes were also not significantly different (t = 0.002, df = 45, p = 0.9) (Fig. 4).

Fig. 3
figure 3

The average proportion of females (S.E) that mated with Microsporidia MB infected versus uninfected males a Rhodamine B fed to Microsporidia MB-infected male mosquitoes b Rhodamine B fed to uninfected male mosquitoes and c Combined Rhodamine fed and unfed Microsporidia MB-infected and uninfected male mosquitoes

Full size image
Fig. 4
figure 4

Box plot of wing length (in mm) of a Microsporidia MB-infected and uninfected males and b wing length of females that mated with Microsporidia MB-infected males and uninfected males

Full size image

Males Microsporidia MB prevalence in swarms and outside swarms

In total, 653 An. arabiensis males were caught indoors and outdoors outside swarms, and 3194 swarming An. arabiensis males were caught from a total of 30 swarms. In the swarm collection, 87 (2.7%) of the male mosquitoes were infected with Microsporidia MB which was significantly higher than the 6 (0.9%) in the male mosquitoes (χ2 = 7.514, df = 1, p < 0.0061) caught outside swarms. The average wing length of swarming males was 2.39 (S.D., 0.43), and of males caught outside swarms was 2.43 (S.D., 0.72); there was no significant difference between the wing lengths of two groups (t = − 0.9, df = 439, p = 0.3).

Discussion

In this study a moderate, although heterogenous, horizontal transmission of Microsporidia MB was recorded especially from male mosquitoes to female mosquitoes. Microsporidia MB-infected male mosquitoes also showed a higher mating frequency and competitiveness compared to uninfected males in the laboratory. The prevalence of Microsporidia MB-infected males was also found to be higher in swarms compared to the dispersed male population at the same field site.

Transmission heterogeneity in host-parasite systems is not uncommon and can be due to environmental, physiological, behavioural, and genetic factors [46, 47]. Mating success is also known to be very variable [48]. In this study, mating rate, and mosquito body size do not explain the heterogeneity. Microsporidia MB density in the donor male or female mosquitoes also does not account for the heterogeneity. Mosquitoes were collected from the same field site and any significant variation in the Microsporidia MB strain is unlikely. The mosquito collection and experiments were, however, carried out over time during which, the climatic conditions may have affected the horizontal transmission rate [9, 13]. Identifying and testing possible factors that cause heterogeneity will be essential in developing a super-spreading strategy for Microsporidia MB.

Similar to previous studies the horizontal transmission rate of Microsporidia MB was higher from male to female compared to female to male [11, 13]. Previously it was shown that Microsporidia MB infective spores were transferred with the ejaculation to the female resulting in higher transmission [13]. In the case of female-to-male, the mode of transfer is being investigated, but it may be because little to no tissue or fluid is transferred from female to male during copulation.

In this study, no Microsporidia MB transmission was reported from 3–4 day old An. arabiensis females to males. In An. gambiae s.s., the horizontal transmission was observed from female to male but in 5–7 days mosquitoes [11]. The study on horizontal transmission in An. arabiensis did not specify the age of the adults and, therefore, it is not possible to compare [13]. Microsporidia MB is already present in the guts and gonads of 2-day-old female and male mosquitoes and there is a decline in Microsporidia MB density between days 7 and 14 [26]. This indicates that the density of Microsporidia MB is not the only factor important for horizontal transmission, as male mosquitoes transmitted Microsporidia MB in all three age groups tested, ranging from 3 to 14 days. Microsporidia MB male mosquitoes mated at an estimated 21–24 day old male mosquitoes in the mating competitiveness experiment. In nature, female mosquitoes mate once and earlier in their lifetime during which no horizontal transmission was observed. Male mosquitoes on the other hand mate multiple times and are more efficient in transmitting Microsporidia MB. This supports the male-only mosquito release approach which is expected to have a higher acceptance in the community due to fear of an increase in mosquito bites if mosquitoes are released in the proximity of the homesteads [24].

Microsporidia MB density in the infected males was not related to the Microsporidia MB density in the recipient females, successful transmission, or the number of times the male mosquito mated. Previous studies also showed that the Microsporidia MB density of the male mosquitoes is not related to horizontal transmission or the number of matings and suggested that this may be because the density represents the Microsporidia MB localized not only in the gonads but also in the midgut and fatty bodies; correlation may be found if only gonad Microsporidia MB-density is considered [13, 26]. Interestingly, this study reports that Microsporidia MB density in the infected female was related to Microsporidia MB density in the recipient males. In Anopheles mosquitoes the ovaries are considerably larger than the testis; the testis is approximately 0.4 mm in length while the ovary is 2 mm in length [49, 50]. It may be that the female Microsporidia MB density in the ovaries is more representative of the total body load. In the females, there is a proliferation of Microsporidia MB following a blood meal, however, this was not the case in this study as the females were not provided a blood meal [26]. Also noteworthy is that the number of transmission events from female to male mosquitoes was few and more data is required to establish the correlation.

From 3–4 days to death, the mating frequency of Microsporidia MB-infected male mosquitoes was found to be almost double that of uninfected male mosquitoes. Also, more females mated with Microsporidia MB-infected male mosquitoes compared to uninfected males. This partially explains the higher-than-expected transmission rate in the age group experiments. Male mosquitoes need to successfully mate with wild females for strategies based on reproductive control such as sterile insect technique, transgenic mosquitoes, and Wolbachia to be successful [48]. Generally, if the mating competitiveness of the male mosquitoes is equivalent to their wild competitors or even slightly lower, it is considered sufficient [30, 51,52,53]. These results suggest that a strategy based on releasing male Microsporidia MB-infected mosquitoes to increase Microsporidia MB prevalence in natural populations is likely to be successful. This is also supported by data that shows that a higher proportion of males caught from swarms were Microsporidia MB-infected compared to those outside swarms.

This study was conducted with F1 progeny of field-collected Microsporidia MB-infected An. arabiensis mothers and are, therefore, representative of the natural population. However, it is noticeable that insectary mosquitoes used in the experiments were comparable in mating rate and wing size, which may be due to the semi-field rearing conditions. Mosquito releases will require colonization and mass production of Microsporidia MB-infected mosquitoes which can influence the mating competitiveness [48, 54, 55]. Mass production under semi-field conditions may assist in the preservation of mating competitiveness allowing the released mosquitoes to disperse over considerable ranges, locate appropriate mating venues, and compete with wild males but will also introduce the risk of seasonal population crashes and variation in the quality of mosquitoes produced [56].

This study offers promising insights into the horizontal transmission of Microsporidia MB in Anopheles mosquitoes. However, the mechanisms underlying the increased mating competitiveness of Microsporidia MB-infected male mosquitoes require further investigation. Symbionts may influence host odour, potentially making them more attractive, or enhancing the host's overall development and reproductive fitness [57, 58]. Also, transmission to females in subsequent matings and mating preference of Microsporidia MB-infected males for Microsporidia MB-infected versus uninfected females need to be established. Future research must also determine if the higher mating frequency and competitiveness translate to more offspring. The results will also need to be validated in semi-field conditions.

In conclusion, Microsporidia MB is transmitted horizontally through mating, with Microsporidia MB-infected male mosquitoes demonstrating nearly twice the competitiveness of their uninfected counterparts. These findings provide valuable insights for developing strategies to disseminate Microsporidia MB in natural mosquito populations for malaria control, particularly through male mosquito releases. However, further research is needed to understand the mechanisms driving increased mating frequency and competitiveness and to validate these findings under semi-field conditions.

Data availability

Data is provided within the manuscript or supplementary information files.

References

  1. WHO. World Malaria Report 2023. Geneva: World Health Organization.

  2. The VP. WHO World malaria report Lancet Microbe. 2023;2024(5): e214.

    Google Scholar 

  3. World Health Organization. Global technical strategy for malaria 2016–2030. Geneva: World Health Organization; 2015.

    Google Scholar 

  4. Rosenthal PJ. Malaria in 2022: Challenges and Progress. Am J Trop Med Hyg. 2022;106:1565–7.

    Article  PubMed  PubMed Central  Google Scholar 

  5. Noor AM, Alonso PL. The message on malaria is clear: progress has stalled. Lancet. 2022;399:1777.

    Article  PubMed  PubMed Central  Google Scholar 

  6. Emiru T, Getachew D, Murphy M, Sedda L, Ejigu LA, Bulto MG, et al. Evidence for a role of Anopheles stephensi in the spread of drug- and diagnosis-resistant malaria in Africa. Nat Med. 2023;29:3203–11.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  7. Samarasekera U. A missed opportunity? Anopheles stephensi in Africa Lancet. 2022;400:1914–5.

    PubMed  Google Scholar 

  8. Brake S, Gomez-Maldonado D, Hummel M, Zohdy S, Peresin MS. Understanding the current state-of-the-art of long-lasting insecticide nets and potential for sustainable alternatives. Curr Res Parasitol Vector-Borne Dis. 2022;2: 100101.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  9. Herren JK, Mbaisi L, Mararo E, Makhulu EE, Mobegi VA, Butungi H, et al. A microsporidian impairs Plasmodium falciparum transmission in Anopheles arabiensis mosquitoes. Nat Commun. 2020;11:2187.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  10. Akorli J, Akorli EA, Tetteh SNA, Amlalo GK, Opoku M, Pwalia R, et al. Microsporidia MB is found predominantly associated with Anopheles gambiae s.s and Anopheles coluzzii in Ghana. Sci Rep. 2021;11:18658.

  11. Nattoh G, Onyango B, Makhulu EE, Omoke D, Ang’ang’o LM, Kamau L, et al. Microsporidia MB in the primary malaria vector Anopheles gambiae sensu stricto is avirulent and undergoes maternal and horizontal transmission. Parasit Vectors. 2023;16:335.

  12. Moustapha LM, Sadou IM, Arzika II, Maman LI, Gomgnimbou MK, Konkobo M, et al. First identification of Microsporidia MB in Anopheles coluzzii from Zinder City. Niger Parasit Vectors. 2024;17:39.

    Article  PubMed  Google Scholar 

  13. Nattoh G, Maina T, Makhulu EE, Mbaisi L, Mararo E, Otieno FG, et al. Horizontal transmission of the symbiont Microsporidia MB in Anopheles arabiensis. Front Microbiol. 2021;12.

  14. Bukhari T, Pevsner R, Herren JK. Microsporidia: a promising vector control tool for residual malaria transmission. Front Trop Dis. 2022;3: 957109.

    Article  Google Scholar 

  15. Bartumeus F, Costa GB, Eritja R, Kelly AH, Finda M, Lezaun J, et al. Sustainable innovation in vector control requires strong partnerships with communities. PLoS Negl Trop Dis. 2019;13: e0007204.

    Article  PubMed  PubMed Central  Google Scholar 

  16. Finda MF, Okumu FO, Minja E, Njalambaha R, Mponzi W, Tarimo BB, et al. Hybrid mosquitoes? Evidence from rural Tanzania on how local communities conceptualize and respond to modified mosquitoes as a tool for malaria control. Malar J. 2021;20:134.

    Article  PubMed  PubMed Central  Google Scholar 

  17. Ritchie SA, Staunton KM. Reflections from an old Queenslander: can rear and release strategies be the next great era of vector control? Proc R Soc B Biol Sci. 2019;286:20190973.

    Article  Google Scholar 

  18. Beisel U, Boëte C. The flying public health tool: genetically modified mosquitoes and malaria control. Sci Cult. 2013;22:38–60.

    Article  Google Scholar 

  19. Resnik DB. Two unresolved issues in community engagement for field trials of genetically modified mosquitoes. Pathog Glob Health. 2019;113:238–45.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  20. Resnik DB. Ethical issues in field trials of genetically modified disease-resistant mosquitoes. Dev World Bioeth. 2014;14:37–46.

    Article  PubMed  Google Scholar 

  21. Finda MF, Christofides N, Lezaun J, Tarimo B, Chaki P, Kelly AH, et al. Opinions of key stakeholders on alternative interventions for malaria control and elimination in Tanzania. Malar J. 2020;19:164.

    Article  PubMed  PubMed Central  Google Scholar 

  22. Rotimi CN, Marshall PA. Tailoring the process of informed consent in genetic and genomic research. Genome Med. 2010;2:20.

    Article  PubMed  PubMed Central  Google Scholar 

  23. Yao FA, Millogo A-A, Epopa PS, North A, Noulin F, Dao K, et al. Mark-release-recapture experiment in Burkina Faso demonstrates reduced fitness and dispersal of genetically-modified sterile malaria mosquitoes. Nat Commun. 2022;13:796.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  24. Bukhari T, Gichuhi J, Mbare O, Ochwal VA, Fillinger U, Herren JK. Willingness to accept and participate in a Microsporidia MB-based mosquito release strategy: a community-based rapid assessment in western Kenya. Malar J. 2024;23:113.

    Article  PubMed  PubMed Central  Google Scholar 

  25. Onchuru TO, Makhulu EE, Ronnie PC, Mandere S, Otieno FG, Gichuhi J, et al. The Plasmodium transmission-blocking symbiont, Microsporidia MB, is vertically transmitted through Anopheles arabiensis germline stem cells. PLoS Pathog. 2024;20: e1012340.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  26. Makhulu EE, Onchuru TO, Gichuhi J, Otieno FG, Wairimu AW, Muthoni JN, et al. Localization and tissue tropism of the symbiont Microsporidia MB in the germ line and somatic tissues of Anopheles arabiensis. mBio. 2023;15:e02192–23.

  27. Rowe M, Veerus L, Trosvik P, Buckling A, Pizzari T. The reproductive microbiome: An emerging driver of sexual selection, sexual conflict, mating systems, and reproductive isolation. Trends Ecol Evol. 2020;35:220–34.

    Article  PubMed  Google Scholar 

  28. Clements AN. The regulation of adult behaviour. In: Clements AN (ed.); The biology of mosquitoes, Vol. 2: Sensory reception and behaviour. CABI Publ. 2023. p. 239–62.

  29. Crompton B, Thomason JC, McLachlan A. Mating in a viscous universe: the race is to the agile, not to the swift. Proc R Soc B Biol Sci. 2003;270:1991–5.

    Article  Google Scholar 

  30. Maïga H, Dabiré RK, Lehmann T, Tripet F, Diabaté A. Variation in energy reserves and role of body size in the mating system of Anopheles gambiae. J Vector Ecol. 2012;37:289–97.

    Article  PubMed  Google Scholar 

  31. Segoli M, Hoffmann AA, Lloyd J, Omodei GJ, Ritchie SA. The effect of virus-blocking Wolbachia on male competitiveness of the dengue vector mosquito. Aedes aegypti PLoS Negl Trop Dis. 2014;8: e3294.

    Article  PubMed  Google Scholar 

  32. Ameneshewa B, Service MW. The relationship between female body size and survival rate of the malaria vector Anopheles arabiensis in Ethiopia. Med Vet Entomol. 1996;10:170–2.

    Article  PubMed  Google Scholar 

  33. Møller AP, Christe P, Lux E. Parasitism, host immune function, and sexual selection. Q Rev Biol. 1999;74:3–20.

    Article  PubMed  Google Scholar 

  34. Beltran-Bech S, Richard F-J. Impact of infection on mate choice. Anim Behav. 2014;90:159–70.

    Article  Google Scholar 

  35. Dunn PO, Bollmer JL, Freeman-Gallant CR, Whittingham LA. MHC variation is related to a sexually selected ornament, survival, and parasite resistance in common yellowthroats. Evol Int J Org Evol. 2013;67:679–87.

    Article  CAS  Google Scholar 

  36. Martinez-Padilla J, Vergara P, Mougeot F, Redpath SM. Parasitized mates increase infection risk for partners. Am Nat. 2012;179:811–20.

    Article  PubMed  Google Scholar 

  37. Hurst GDD, Frost CL. Reproductive parasitism: maternally inherited symbionts in a biparental world. Cold Spring Harb Perspect Biol. 2015;7: a017699.

    Article  PubMed  PubMed Central  Google Scholar 

  38. Degefa T, Yewhalaw D, Zhou G, Lee M, Atieli H, Githeko AK, et al. Indoor and outdoor malaria vector surveillance in western Kenya: implications for better understanding of residual transmission. Malar J. 2017;16:443.

    Article  PubMed  PubMed Central  Google Scholar 

  39. Morgan JC, Irving H, Okedi LM, Steven A, Wondji CS. Pyrethroid resistance in an Anopheles funestus population from Uganda. PLoS ONE. 2010;5: e11872.

    Article  PubMed  PubMed Central  Google Scholar 

  40. Santolamazza F, Mancini E, Simard F, Qi Y, Tu Z, della Torre A. Insertion polymorphisms of SINE200 retrotransposons within speciation islands of Anopheles gambiae molecular forms. Malar J. 2008;7:163.

    Article  PubMed  PubMed Central  Google Scholar 

  41. Dimopoulos G, Seeley D, Wolf A, Kafatos FC. Malaria infection of the mosquito Anopheles gambiae activates immune-responsive genes during critical transition stages of the parasite life cycle. EMBO J. 1998;17:6115–23.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  42. Takken W, Klowden MJ, Chambers GM. Effect of body size on host seeking and blood meal utilization in Anopheles gambiae sensu stricto (Diptera: Culicidae): the disadvantage of being small. J Med Entomol. 1998;35:639–45.

    Article  CAS  PubMed  Google Scholar 

  43. Nasci RS. Relationship of wing length to adult dry weight in several mosquito species (Diptera: Culicidae). J Med Entomol. 1990;27:716–9.

    Article  CAS  PubMed  Google Scholar 

  44. Ngowo HS, Hape EE, Matthiopoulos J, Ferguson HM, Okumu FO. Fitness characteristics of the malaria vector Anopheles funestus during an attempted laboratory colonization. Malar J. 2021;20:148.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  45. Li I, Mak KW, Wong J, Tan CH. Using the fluorescent dye, Rhodamine B, to study mating competitiveness in male Aedes aegypti mosquitoes. J Vis Exp. 2021;171:62432.

    Google Scholar 

  46. Vander-Waal KL, Ezenwa VO. Heterogeneity in pathogen transmission: mechanisms and methodology. Funct Ecol. 2016;30:1606–22.

    Article  Google Scholar 

  47. Vazquez-Prokopec GM, Perkins TA, Waller LA, Lloyd AL, Reiner RC, Scott TW, et al. Coupled heterogeneities and their impact on parasite transmission and control. Trends Parasitol. 2016;32:356–67.

    Article  PubMed  PubMed Central  Google Scholar 

  48. Cator LJ, Wyer CAS, Harrington LC. Mosquito sexual selection and reproductive control programs. Trends Parasitol. 2021;37:330–9.

    Article  PubMed  PubMed Central  Google Scholar 

  49. Pinch M, Mitra S, Rodriguez SD, Li Y, Kandel Y, Dungan B, et al. Fat and happy: Profiling mosquito fat body lipid storage and composition post-blood meal. Front Insect Sci. 2021;1.

  50. Catteruccia F, Crisanti A, Wimmer EA. Transgenic technologies to induce sterility. Malar J. 2009;8:S7.

    Article  PubMed  PubMed Central  Google Scholar 

  51. Helinski ME, Hassan MM, El-Motasim WM, Malcolm CA, Knols BG, El-Sayed B. Towards a sterile insect technique field release of Anopheles arabiensis mosquitoes in Sudan: Irradiation, transportation, and field cage experimentation. Malar J. 2008;7:65.

    Article  PubMed  PubMed Central  Google Scholar 

  52. Chambers EW, Hapairai L, Peel BA, Bossin H, Dobson SL. Male mating competitiveness of a Wolbachia-introgressed Aedes polynesiensis strain under semi-field conditions. PLoS Negl Trop Dis. 2011;5: e1271.

    Article  PubMed  PubMed Central  Google Scholar 

  53. Kaiser PE, Bailey DL, Lowe RE, Seawright JA, Dame DA. Mating competitiveness of chemosterilized males of a genetic sexing strain of Anopheles albimanus in laboratory and field tests. Mosq News. 1979;39:768–75.

    Google Scholar 

  54. Ekechukwu NE, Baeshen R, Traorè SF, Coulibaly M, Diabate A, Catteruccia F, et al. Heterosis increases fertility, fecundity, and survival of laboratory-produced F1 hybrid males of the malaria mosquito Anopheles coluzzii. G3 Bethesda Md. 2015;5:2693–709.

  55. Nignan C, Poda BS, Sawadogo SP, Maïga H, Dabiré KR, Gnankine O, et al. Local adaptation and colonization are potential factors affecting sexual competitiveness and mating choice in Anopheles coluzziipopulations. Sci Rep. 2022;12:636.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  56. Howell PI, Knols BG. Male mating biology. Malar J. 2009;8:S8.

    Article  PubMed  PubMed Central  Google Scholar 

  57. Richard F-J. Symbiotic bacteria influence the odor and mating preference of their hosts. Front Ecol Evol. 2017;5:143.

    Article  Google Scholar 

  58. Zhang Q, Cai P, Wang B, Liu X, Lin J, Hua R, et al. Manipulation of gut symbionts for improving the sterile insect technique: quality parameters of Bactrocera dorsalis (Diptera: Tephritidae) genetic sexing strain males after feeding on bacteria-enriched diets. J Econ Entomol. 2021;114:560–70.

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

We acknowledge the assistance of David Alila, Charles Amara, and Mary Kamanthe from the ICIPE Mbita field and insectary team. Ian Okello and Elizabeth Baraza from the molecular laboratory team and the support from Faith Kyengo as the project administrator.

Funding

The authors gratefully acknowledge the financial support for this research by the following organizations and agencies: Open Philanthropy (SYMBIOVECTOR Track A to JKH), the Bill and Melinda Gates Foundation (INV0225840 to JKH), and the Children’s Investment Fund Foundation (SMBV-FFT to JKH). This work was also supported by funds from the Swedish International Development Cooperation Agency (Sida); the Swiss Agency for Development and Cooperation (SDC); the Australian Centre for International Agricultural Research (ACIAR); the Government of Norway; the German Federal Ministry for Economic Cooperation and Development (BMZ); and the Government of the Republic of Kenya to icipe. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Author information

Authors and Affiliations

  1. Global Health Thematic Research Programme, International Centre of Insect Physiology and Ecology (Icipe), P.O. Box 30772 - 00100, Nairobi, Kenya

    Tracy Maina, Aclaine Shisia, Joseph Gichuhi, Jeremy K. Herren & Tullu Bukhari

  2. Department of Biochemistry, Jomo Kenyatta University of Agriculture and Technology (JKUAT), P.O. Box, 62000 - 00200, Nairobi, Kenya

    Tracy Maina & Joel L. Bargul

Authors
  1. Tracy Maina
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Aclaine Shisia
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Joseph Gichuhi
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Joel L. Bargul
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Jeremy K. Herren
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Tullu Bukhari
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

T.M. conducted the experiments and data collection, contributed to data analysis, and wrote the first version of the manuscript. AS contributed to experiments and data collection and revising the later drafts of the manuscript, J.G. contributed to designing part of the experiments and revising the later drafts of the manuscript, J.B. contributed to conceiving the experiment design and revising the later drafts of the manuscript. J.K.H. conceived the study, supervised the data analysis and revised the manuscript, T.B. conceived the study design, supervised experiments, data collection, and analysis, and revised the manuscript.

Corresponding authors

Correspondence to Jeremy K. Herren or Tullu Bukhari.

Ethics declarations

Competing interests

The authors declare no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Maina, T., Shisia, A., Gichuhi, J. et al. Maximizing horizontal transmission through mating: increased mating frequency and mating competitiveness associated with Microsporidia MB-infected Anopheles arabiensis males. Malar J 24, 114 (2025). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12936-025-05354-1

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12936-025-05354-1

Malaria Journal

ISSN: 1475-2875

Contact us