Skip to main content
Download PDF

Low prevalence of copy number variation in pfmdr1 and pfpm2 in Plasmodium falciparum isolates from southern Angola

Malaria Journal volume 24, Article number: 5 (2025) Cite this article

Abstract

Background

Malaria is the parasitic disease with the highest global morbidity and mortality. According to estimates from the World Health Organization (WHO), there were around 249 million cases in 2022, with 3.4% occurring in Angola. The emergence and spread of drug-resistant Plasmodium falciparum have compromised anti-malarial efficacy and threatens malaria elimination campaigns using artemisinin-based combination therapy (ACT). Increased copy number (CNV) of the P. falciparum gene plasmepsin 2 (pfpm2) have been reported to confer parasite tolerance to piperaquine (PPQ) and the multidrug resistance-1 (pfmdr1), resistance to mefloquine (MEF) and decreased susceptibility to lumefantrine (LUM). PPQ, MEF and LUM are ACT partner drugs. Therefore, CNV detection is a useful tool to track ACT resistance risk. The potential for future treatment failure of artemisinin-based combinations (that include PPQ, LUM and AMQ), due to parasite resistance in the region, emphasizes the need for continued molecular surveillance.

Methods

One hundred and nine clinically derived samples were collected at Hospital Central Dr. António Agostinho Neto (HCL) in Lubango, Angola. qPCR targeting the small-subunit 18S rRNA gene was used to confirm P. falciparum infection. Copy number estimates were determined using a SYBR green-based quantitative PCR assay.

Results

Overall, this study revealed a low number of resistance CNVs present in the parasite population at Lubango, for the genes pfmdr1 and pfpm2. Of the 102 samples successfully analysed for pfpm2 10 (9.8%) carried increased CNV and 9/101 (8.9%) carried increased CNV of pfmdr1.

Conclusions

This study provides, for the first time, evidence for the presence of CNVs in the pfpm2 and pfmdr1 genes in P. falciparum isolates from southern Angola.

Background

Malaria is a vector-borne disease caused by Plasmodium protozoa and transmitted through the bite of infected female mosquitoes from the genus Anopheles. According to the World Health Organization (WHO), the great majority of malaria cases and deaths, attributed to Plasmodium falciparum, occur in sub-Saharan Africa, with approximately 249 million cases and over 608.000 deaths reported in 2022 [1].

Angola, a country in Western coast of Southern Africa, recorded more than 8.3 million malaria cases in 2022. Incidence and mortality rate due to malaria was 25–55% higher in 2022 than in 2015 in the country [2].

Malaria burden in Angola is divided into three distinct zones based on climate: high transmission year-round in the north, mesoendemic in the center, and seasonal malaria (unstable) in the south, where Lubango (the capital of Huíla province, see Fig. 1) is located [3]. The country began recommending ACT (Artemisinin-based Combination Therapy) as first-line treatment for uncomplicated malaria in 2005. From 2006, ACT was introduced, and currently, the first-line treatment combinations in Angola are artemether-lumefantrine (AL), artesunate-amodiaquine (ASAQ) and dihydroartemisinin-piperaquine (DHA-PPQ) [4]. After administration, artemisinin derivatives are converted to DHA, which is primarily responsible for the drug's anti-malarial activity [5].

Fig. 1
figure 1

Summary of sample processing and map of Angola highlighting study site. Pin, Lubango city and malaria incidence areas. Huíla province in dark green

Full size image

According to the WHO, treatment failures due to parasite resistance remains < 10% in Africa [6] and the resistance to DHA-PPQ has not yet emerged in Africa. However, there are some cases of clinical failures with DHA-PPQ in Asia [7,8,9,10]. In Angola, AL has a reported (in 2024) adequate clinical and parasitological response of treatment of uncomplicated malaria of 88.0% to 94.4%, ASAQ 91.0 to 100%, artesunate-pyronaridine (ASPY) 99.6% (depending on the geographical region) and for DHA-PPQ 98.3% [11].

Plasmodium falciparum partial resistant parasites to artemisinin derivatives were first identified in 2008 in Southeast Asia [12,13,14]. Since then, resistant parasites have been detected in Africa, posing a threat to the current efforts to control this disease in Africa [15,16,17].

Decreased parasite susceptibility to lumefantrine (LUM) can be modulated by pfmdr1 (P. falciparum multidrug drug resistance gene 1) [18,19,20]. pfmdr1 codes for a digestive vacuole transmembrane protein that allows the importation of solutes into the parasite's digestive vacuole [18]. Single nucleotide polymorphisms and increased copy number in pfmdr1 have been associated with resistance to MEF and potentially LUM decreased susceptibility. Treatment with AL selects for the pfmdr1 haplotype N86/184F/D1246, while DHA-PPQ treatment, although at a lower level than ASAQ, selects for the opposite haplotype 86Y/Y184/Y1246 [20, 21]. Increased pfmdr1 copy number (carrying the SNPs N86/184F) has been associated with decreased susceptibly to lumefantrine [22]. And It has been hypothesized that increased pfmdr1 copy number is associated with enhanced accumulation of PPQ in the digestive vacuole (DV), leading to increased sensitization to PPQ [18]. The increased copy number of another P. falciparum gene, the plasmepsin 2 gene (pfpm2) has been associated with clinical treatment failures with DHA-PPQ, in Southeast Asia [19, 23, 24]. Plasmepsin 2, a food vacuole enzyme and is considered a major piperaquine target [23, 25]. The apparent opposing selection pressures of LUM on pfmdr1 suggest that DHA-PPQ may be a good choice of partner drug in areas where AL was previously largely used [8,9,10, 19, 23, 24]. Although some authors [23, 25, 26] consider pfpm2 amplification sufficient to confer PPQ resistance without additional gene mutations (e.g., P. falciparum chloroquine resistance transporter; pfcrt), others argue that plasmepsin amplification alone is not enough. It may facilitate the selection of mutations in other P. falciparum genes, such as pfcrt, pfmdr1 or P. falciparum exonuclease (pfexo), which could, in turn, enhance PPQ resistance levels [27, 28]. In fact, increased CNV in pfmdr1 and pfpm2 were observed in certain African countries [23], even before significant changes in parasite clearance time (the phenotypic manifestation of artemisinin derivative tolerance) [17] or mutations in the pfK13 gene (which encodes the Kelch 13 protein responsible for P. falciparum's reduced susceptibility to artemisinin derivatives) were detected [29,30,31].

The close relationship between A/T track-hairpin sequences in the genome of P. falciparum leads to the use of microhomology-mediated pathways, which are prone to errors. These events seem to lead to a greater generation of CNVs and contribute to the adaptability of this parasite under selective pressure (namely drugs) [32]. Although CNVs often entail a significant fitness cost [33] there are evidences that CNV formation, is the initial stage in P. falciparum that leads to the accumulation of SNPs that confer resistance [34, 35]. These findings prompted the present study to assess whether the increased copy number of genes that pfmdr1 and pfpm2 are already present in parasites currently circulating in Angola.

Methods

Ethics statement

Blood samples were collected following individual oral consent and signed informed written consent from all participants or their guardians. Ethical clearance for the work was obtained from: Comité de Ética Independente da Faculdade de Medicina da Universidade Agostinho Neto and by the Hospital Central Dr. António Agostinho Neto (HCL) institutional ethics review committee (deliberation Nº08/2020, on 14 November 2020).

Study site

Patients were enrolled at the Emergency Department (ED) of the Hospital Central Dr. António Agostinho Neto of Lubango (hereafter designated HCL), Huíla province, Angola (Fig. 1) from February to June 2023. The HCL is a tertiary-level, regional institution located in the capital of Huíla province. It treats adult patients (> 16 years old) referred from all 14 municipalities in the province and from three other provinces in the southern region of Angola: Cuando-Cubango, Cunene, Namibe, as well as some neighbouring municipalities in Huambo province, totalling a population of approximately 6,500,000 inhabitants. HCL does not provide care for children under 16 years of age or pregnant women. In Huíla province alone, there are around 2.5 million inhabitants (10% Angola's population) at risk of contracting malaria. Malaria transmission in Huíla province is classified as unstable meso-endemic, with periods of low transmission during the months of May to December, and epidemic peaks during the rainy season, mainly in the months of January to April [3, 36].

Samples

Patients presenting at the emergency room of HCL were chosen for the study based on the inclusion criteria: Rapid Diagnostic Test (RDT) or thick smear by optical microscopy (OM) positive for Plasmodium spp., and consenting to participate. A total of 109 participants with malaria positive RDT or positive thick smear were recruited after consent and provided 200 μL of blood samples on filter papers (WHA10534320). All dried blood spot samples were then stored at − 20 °C until they were used for genotyping. To confirm presence of P. falciparum infection, parasite genomic DNA from dried blood spots was extracted using the Chelex method [37] and stored at − 20 °C. qPCR reactions targeting the 18S rRNA gene were conducted for confirmation, as described elsewhere [38] with modifications. Briefly, forward primer 5′-TATTGCTTTTGAGAGGTTTTGTTACTTTG-3′ and reverse primer ACCTCTGACATCTGAATACGAATGC and the probe FAM-ACGGGTAGTCATGATTGAGTT-MGB-BHQ (Integrated DNA Technologies-IDT) were used. PCR reaction mixture consisted of 7.5 μL of 2X NZYSupreme qPCR Probe master mix (NZYTECH, Portugal), 600 nM of each primer and 200 nM of probe, 2μL of genomic DNA and water up to 15 μL. Negative controls (H20) were include in each PCR run. PCR conditions: 3 min a 95 °C, followed by 40 cycles a 95 °C for 5 s and a 58 °C for 40 s. Each sample was tested in triplicate in Bioer´s Line-Gene 9600 real_time PCR detection System™ (Biosan,SIA). All reactions were performed with positive controls (DNA from P. falciparum 3D7 (MRA-102).

Assessment of pfpm2 and pfmdr1 copy numbers was conducted through SYBR Green I quantitative PCR. The pfpm2 gene (PF3D7_1408000) and pfmdr1 (PF3D7_0523000) were evaluated using the single copy gene pfBtubulin (pfβtub; PF3D7_1008700) as reference gene, as previously described [24, 39, 40]. Primers were designed (supplementary material Apendix1) inside the pfpm2 and pfmdr1 genes and as a reference gene, we used the single copy gene pfβtub (PF3D7_1008700). qPCR reactions were carried out in 15 μL volumes within a 96-well plate (Nerbe plus, BioPortugal) on a NZYSupreme qPCR SYBR Green Master mix (2X) (NZYTECH, Portugal). For each reaction, 200 nM of each primer, and 1.5 μL of genomic DNA was used. Negative controls (H20) were include in each qPCR run for each gene. PCR cycling conditions: initial 5 min at 95°C, followed by 45 of 15s at 95°C and 1 min at 60 °C on a Real-Time PCR system Bioer Line-Gene 9600 Real Time PCR detection System™ (Biosan,SIA). Relative copy number was calculated on the basis of the 2−ΔΔCt method for relative quantification. ΔΔCt was calculated as (Ct taget gene in sample—Ct pfBtubin sample)—(Ct target gene in 3D7—Ct pfBtubin 3D7), sample is DNA from each patient and 3D7 is the calibration control of genomic 3D7 (MRA-102) DNA, with one copy of all genes (pfBtub, pfpm2 and pfmdr1)[41]. DNA from an isolate IPC_6261 (MR4-1284) with 3 copies of pfpm2 [41] and DNA from Dd2 (MRA-150) as a reference for multiple copies (3) of pfmdr1 [22, 42,43,44] were used as an internal plate control. Single copy vs multiple copies of pfpm2 and pfmdr1, were defined as copy number < 1.5 and ≥ 1.5 respectively [39, 45].

Amplification efficiencies of pfpm2 and pfmdr1 were similar to pfBtub (supplementary material). Assays were repeated if one of the following three results was obtained: standard variation of triplicate > 0.38 [46] Ct values > 40. Specificities of pfpm2, pfmdr1 and pfbtub amplification curves were evaluated by visualizing the respective melt curves.

Results

Patients and samples

Of the enrolled 109 clinical samples, with malaria positive by Rapid Diagnostic Test (RDT) or thick smear (parasitaemia ranging between 64 and 580,120 parasites/μl blood with a median of 3120 parasites/μl blood) enrolled, 7 (6,4%) were qPCR negative for 18S from P. falciparum. Hence, were removed from further analysis. The remaining 102 DNA samples corresponded to patients that had between 15 and 89 years of age (with a median age 33.5 years), 54.9% (56/102) were males and 45.1% (46/102) females (Fig. 1).

Samples revealed a low level of CNVs both for pfpm2 and pfmdr1

Three different laboratory-adapted parasite lines with known pfpm2 and pfmdr1 copy numbers were used as controls, in order to evaluate the accuracy of the assay. As expected, IPC_6261 (MRA 1284) and Dd2 (MRA 150) displayed a median copy number for pfpm2 of 3.00 (range 2.98–3.40) and pfmdr1 a median copy number of 2.90 (2.80–3.22) [41, 47, 48]; Fig. 2). Each sample was simultaneously analyzed with IPC_6261 for pfpm2 and with Dd2 for pfmdr1. All 102 samples were successfully analyzed for pfpm2 and 101 for pfmdr1 (inserted table of Fig. 2). Using a threshold copy number of ≥ 1.5 as evidence of gene amplification, 10 samples carried more than one copy of pfpm2 and 9 carried more than one copy of pfmdr1, representing 9.8% and 8,9%, respectively (inserted table of Fig. 2). Only two samples, carried simultaneously increased copy number for both genes.

Fig. 2
figure 2

Copy number of pfmdr1 and pfpm2 in P. falciparum samples from Lubango. The x-axis represents the each sample, while the y-axis shows the CNV (copy number variation) of each sample for each gene.Inserted table, number of samples with increased copy number of each gene; 3D7 reference strain (pfmdr1 black circle is superimposed to the clear circle corresponding to pfpm2), Dd2 and IPC_6261, control strains; black circles, mean CNV value for pfmdr1 in each sample; clear circles, mean CNV value for pfpm2 in each sample

Full size image

Discussion

Given the potential risk of spreading ACT-resistant parasites in Africa, it is essential to conduct regional analyses to monitor the circulating parasites. This will improve the development of new therapeutic strategies to enhance the efficacy of anti-malarial drugs. Our study determined the copy number variations of pfpm2 and pfmdr1 in field isolates from Hospital Central of Lubango (HCL). Lubango is the capital of the Huíla province located in the south of Angola (Fig. 1). The examination of pfmdr1 and pfpm2 CNVs in Lubango (Huíla) indicated a low occurrence of CNV 9.8% (10/102) and 8.9% (9/101) respectively. Nevertheless, because HCL is one of the largest hospitals in southern Angola, serving the population of Huíla province as well as the neighbouring provinces of Namibe and Cunene, this study offers valuable insights into the parasite populations throughout the southern region of Angola. Theu objective was not to generalize these findings to the entire country but to determine whether these mutations are already present.

Regarding pfmdr1, 4 studies have been published addressing CNV in Angola. One study from Zaire and Uíge [49] that found no amplification of pfmdr1, and two other studies [50, 51], from Benguela, Lunda Sul, and Zaire that also reported absence of elevated copy number fo pfmdr1. Another study from Luanda [52] reported that 14.1% (13/92) of the samples carried increased pfmdr1 copy numbers. Results presented here revealed a lower prevalence of pfmdr1 CNV (8.9%; with a 95% CI ranging from 3.4 to 14.5%) compared to the 14% (95% CI ranging from 6.9 to 21%) previously reported from Luanda [52]. Luanda, the capital city, with significant international links, is located over 500 km north of Lubango by road. This marginal difference may reflect geographic diversity in pfmdr1 distribution, or may be due to low sample size (ours n = 101 and [52] n = 93). Furthermore, samples from Luanda study [52] were collected nearly 10 years ago (collected in 2011–2013), during which time various therapies have been used in the region, potentially influencing parasite selection. Regarding the other studies from Angola (samples from Lunda Sul, Zaire, Benguela and Uígre, were collected in between 2013–2015 [51]) this results contrast with the absence of amplification of pfmdr1 reported by the authors. In this case, geographic diversity may help explain the differences of CNV prevalence in Lunda Sul and Zaire. Both Lunda Sul and Zaire are located in the northern part of the country, more than 1,200 km by road from Lubango in Huíla. However, this is not the case for Benguela, which borders Huíla province. During which it is conceivable that there may have been changes in the genetic pattern of the parasitic populations in these provinces.

Nevertheless, this findings of low CNV prevalence of pfmdr1, align with other studies in P. falciparum populations from sub-Saharan Africa [47, 48, 53, 54] where the amplification of pfmdr1 is also low but present.

Additionally, the AL combination has been consistently administered in Lubango, which could potentially have led to the selection of parasites exhibiting pfmdr1 amplification (increased mRNA expression levels of pfmdr1 are highly correlated with decreased sensitivity to LUM and DHA [25, 55]. Although pfmdr1 amplification alone does not fully account for reduced susceptibility to LUM and DHA, pfmdr1 copy number variation (CNV) remains a key marker for tracking drug-resistant parasites, particularly concerning resistance to mefloquine.

Regarding pfpm2, there is only one published study from Angola it includes samples from the provinces of Benguela, Lunda Sul, and Zaire (samples collected in 2017) [50]. That study reports the absence of CNV of pfpm2. The assessment of pfpm2 CNVs in Lubango revealed a low frequency (Figs. 1 and 2) of CNV in pfpm2, which is consistent with other reports from sub-Saharan Africa. In these region, P. falciparum isolates have shown varying frequencies of CNVs in the pfpm2 gene ranging from 10.0% in Mali to 33.9% in Uganda [45] and 1.1% to 5% from Mozambique [42, 56, 57] or 2.0% from Kenya [58]. The low frequency of pfpm2 CNV in Lubango (Fig. 2) is consistent with the relatively low rates of DHA-PPQ use in the province (Huíla; personal communication of Professor Lina Antunes, Director of HCL) and in sub-Saharan Africa overall [27, 59, 60]. Although pfpm2 amplification is recognized as sufficient to confer piperaquine resistance [23, 25, 26] some studies argue that amplification of plasmepsins alone is not sufficient, but may facilitate the selection of mutations in other genes, such as pfcrt (SNPs like F145I [59] G367C [60] C350R [27]), thereby potentiating piperaquine resistance levels [27]. In fact, CNVs in Plasmodium seem to eventually be lost in favor of SNPs [61,62,63]. Pfcrt has not yet genotyped in this samples, and to the best of current knowledge, there is no available information on piperaquine susceptibility and pfcrt SNPs in Angola. In contrast with pfpm2, the increased CNV of pfmdr1 has been established as the most useful indicator of multidrug-resistant malaria strains, influencing parasite responses to mefloquine, LUM, and DHA [25, 55, 64]. The detection of PPQ/LUM-resistance molecular markers (pfpm2/pfmdr1 CNV) in Angola, even if at a lower frequency compared to Southeast Asia (SEA), highlights the need for constant surveillance. Additionally, in cases where a patient harbours multiple P. falciparum clones (in Africa the presence of multiple clones in the same individual is not uncommon) some with a single copy and others with multiple copies, the overall CNV could be underestimated. Mixed infections can obscure the presence of clones with higher copy numbers, resulting in a lower average CNV. This is especially important because evidence from SEA suggests that PPQ resistance developed multiple times on different parasite genetic backgrounds [23]. Hence, as DHA-PPQ use in Angola becomes more extensive, the risk of selecting PPQ-resistant parasites increases, posing a threat to the efficacy of the therapy combination. Therefore, with adequate drug pressure, resistant isolates may spread throughout Angola, as was observed in the past in Southeast Asia. Despite the limited sample size and limited geographical focus, on patients from the southern provinces of Angola, the present study demonstrates for the first time that these mutations exist within the local parasite population.

Conclusion

Evidence is provided, for the fist time, of the presence of multiple copies of pfpm2 and pfmdr1 in currently circulating P. falciparum parasites in Lubango, the southern Angola. The study supports the continued need for molecular surveillance, ideally countrywide, to improve the detection of ACT resistance before it becomes widespread.

Availability of data and materials

No datasets were generated or analysed during the current study.

Abbreviations

ACT:

Artemisinin-based combination therapy

AMQ:

Amodiaquine

CNV:

Increased copy number

DHA:

Dihydroartemisinin

HCL:

Hospital Central Dr. António Agostinho Neto in Lubango

LUM:

Lumefantrine

PPQ:

Piperaquine

SEA:

Southeast Asia

WHO:

World Health Organisation

References

  1. WHO. World malaria report 2023. Geneva, World Health Organization, 2023. https://www.who.int/teams/global-malaria-programme/reports/world-malaria-report-2023.

  2. Sacomboio ENM, dos Santos Sebastião C, Salvador ST da C, João JA, Bapolo DVS, Francisco NM, et al. Evaluation of blood cell count parameters as predictors of treatment failure of malaria in Angola: an observational study. PLoS One. 2022;17:e0267671.

  3. Tavares W, Morais J, Martins JF, Scalsky RJ, Stabler TC, Medeiros MM, et al. Malaria in Angola: recent progress, challenges and future opportunities using parasite demography studies. Malar J. 2022;21:396.

    Article  PubMed  PubMed Central  Google Scholar 

  4. Plucinski MM, Dimbu PR, Macaia AP, Ferreira CM, Samutondo C, Quivinja J, et al. Efficacy of artemether–lumefantrine, artesunate–amodiaquine, and dihydroartemisinin–piperaquine for treatment of uncomplicated Plasmodium falciparum malaria in Angola, 2015. Malar J. 2017;16:62.

    Article  PubMed  PubMed Central  Google Scholar 

  5. White NJ. Malaria. In: Finch RG, Greenwood D, Norrby SR, Whitley RJ (eds.). Antibiotic and Chemotherapy. 9th Edn. Saunders Publ. 2010.

  6. WHO. World malaria report 2021. Geneva, World Health Organization, 2021. https://www.who.int/teams/global-malaria-programme/reports/world-malaria-report-2021. Accessed 30 Dec 2024.

  7. Ishengoma DS, Gosling R, Martinez-Vega R, Beshir KB, Bailey JA, Chimumbwa J, et al. Urgent action is needed to confront artemisinin partial resistance in African malaria parasites. Nat Med. 2024;30:1807–8.

    Article  CAS  PubMed  Google Scholar 

  8. Russo G, L’Episcopia M, Menegon M, Souza SS, Dongho BGD, Vullo V, et al. Dihydroartemisinin–piperaquine treatment failure in uncomplicated Plasmodium falciparum malaria case imported from Ethiopia. Infection. 2018;46:867–70.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  9. Gobbi F, Buonfrate D, Menegon M, Lunardi G, Angheben A, Severini C, et al. Failure of dihydroartemisinin-piperaquine treatment of uncomplicated Plasmodium falciparum malaria in a traveller coming from Ethiopia. Malar J. 2016;15:525.

    Article  PubMed  PubMed Central  Google Scholar 

  10. Sagara I, Beavogui AH, Zongo I, Soulama I, Borghini-Fuhrer I, Fofana B, et al. Pyronaridine–artesunate or dihydroartemisinin–piperaquine versus current first-line therapies for repeated treatment of uncomplicated malaria: a randomised, multicentre, open-label, longitudinal, controlled, phase 3b/4 trial. Lancet. 2018;391:1378–90.

    Article  Google Scholar 

  11. Dimbu PR, Labuda S, Ferreira CM, Caquece F, André K, Pembele G, et al. Therapeutic response to four artemisinin-based combination therapies in Angola, 2021. Antimicrob Agents Chemother. 2024;68: e0152523.

    Article  PubMed  Google Scholar 

  12. Phyo AP, Nkhoma S, Stepniewska K, Ashley EA, Nair S, McGready R, et al. Emergence of artemisinin-resistant malaria on the western border of Thailand: a longitudinal study. Lancet. 2012;379:1960–6.

    Article  PubMed  PubMed Central  Google Scholar 

  13. Imwong M, Suwannasin K, Kunasol C, Sutawong K, Mayxay M, Rekol H, et al. The spread of artemisinin-resistant Plasmodium falciparum in the Greater Mekong subregion: a molecular epidemiology observational study. Lancet Infect Dis. 2017;17:491–7.

    Article  PubMed  PubMed Central  Google Scholar 

  14. Dondorp AM, Nosten F, Yi P, Das D, Phyo AP, Tarning J, et al. Artemisinin resistance in Plasmodium falciparum malaria. N Engl J Med. 2009;361:455–67.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  15. Silva-Pinto A, Domingos J, Cardoso M, Reis A, Benavente ED, Caldas JP, et al. Artemether-lumefantrine treatment failure of uncomplicated Plasmodium falciparum malaria in travellers coming from Angola and Mozambique. Int J Infect Dis. 2021;110:151–4.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  16. Blasco B, Leroy D, Fidock DA. Antimalarial drug resistance: linking Plasmodium falciparum parasite biology to the clinic. Nat Med. 2017;23:917–28.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  17. Ashley EA, Dhorda M, Fairhurst RM, Amaratunga C, Lim P, Suon S, et al. Spread of artemisinin resistance in Plasmodium falciparum malaria. N Engl J Med. 2014;371:411–23.

    Article  PubMed  PubMed Central  Google Scholar 

  18. Veiga MI, Ferreira PE, Malmberg M, Jörnhagen L, Björkman A, Nosten F, et al. pfmdr1 amplification is related to increased Plasmodium falciparum in vitro sensitivity to the bisquinoline piperaquine. Antimicrob Agents Chemother. 2012;56:3615–9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  19. Amato R, Lim P, Miotto O, Amaratunga C, Dek D, Pearson RD, et al. Genetic markers associated with dihydroartemisinin–piperaquine failure in Plasmodium falciparum malaria in Cambodia: a genotype–phenotype association study. Lancet Infect Dis. 2017;17:164–73.

    Article  CAS  PubMed  Google Scholar 

  20. Conrad MD, LeClair N, Arinaitwe E, Wanzira H, Kakuru A, Bigira V, et al. Comparative impacts over 5 years of artemisinin-based combination therapies on Plasmodium falciparum polymorphisms that modulate drug sensitivity in Ugandan Children. J Infect Dis. 2014;210:344–53.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Taylor AR, Flegg JA, Holmes CC, Guérin PJ, Sibley CH, Conrad MD, et al. Artemether-lumefantrine and dihydroartemisinin-piperaquine exert inverse selective pressure on Plasmodium falciparum drug sensitivity-associated haplotypes in Uganda. Open Forum Infect Dis. 2017;4:ofw229.

  22. Calçada C, Silva M, Baptista V, Thathy V, Silva-Pedrosa R, Granja D, et al. Expansion of a specific Plasmodium falciparum PfMDR1 Haplotype in Southeast Asia with increased substrate transport. mBio. 2020;11:e02093–20.

  23. Bopp S, Magistrado P, Wong W, Schaffner SF, Mukherjee A, Lim P, et al. Plasmepsin II–III copy number accounts for bimodal piperaquine resistance among Cambodian Plasmodium falciparum. Nat Commun. 2018;9:1769.

    Article  PubMed  PubMed Central  Google Scholar 

  24. Witkowski B, Duru V, Khim N, Ross LS, Saintpierre B, Beghain J, et al. A surrogate marker of piperaquine-resistant Plasmodium falciparum malaria: a phenotype–genotype association study. Lancet Infect Dis. 2017;17:174–83.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  25. Kubota R, Ishino T, Iwanaga S, Shinzawa N. Evaluation of the effect of gene duplication by genome editing on drug resistance in Plasmodium falciparum. Front Cell Infect Microbiol. 2022;12: 915656.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  26. Boonyalai N, Thamnurak C, Sai-ngam P, Ta-aksorn W, Arsanok M, Uthaimongkol N, et al. Plasmodium falciparum phenotypic and genotypic resistance profile during the emergence of Piperaquine resistance in Northeastern Thailand. Sci Rep. 2021;11:13419.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  27. Florimond C, de Laval F, Early AM, Sauthier S, Lazrek Y, Pelleau S, et al. Impact of piperaquine resistance in Plasmodium falciparum on malaria treatment effectiveness in The Guianas: a descriptive epidemiological study. Lancet Infect Dis. 2024;24:161–71.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Moss S, Mańko E, Krishna S, Campino S, Clark TG, Last A. How has mass drug administration with dihydroartemisinin-piperaquine impacted molecular markers of drug resistance? A systematic review Malar J. 2022;21:186.

    CAS  PubMed  Google Scholar 

  29. Maiga AW, Fofana B, Sagara I, Dembele D, Dara A, Traore OB, et al. No evidence of delayed parasite clearance after oral artesunate treatment of uncomplicated falciparum malaria in Mali. Am J Trop Med Hyg. 2012;87:23–8.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Ouattara A, Kone A, Adams M, Fofana B, Maiga AW, Hampton S, et al. Polymorphisms in the K13-propeller gene in artemisinin-susceptible Plasmodium falciparum parasites from Bougoula-Hameau and Bandiagara. Mali Am J Trop Med Hyg. 2015;92:1202–6.

    Article  CAS  PubMed  Google Scholar 

  31. Ariey F, Witkowski B, Amaratunga C, Beghain J, Langlois A-C, Khim N, et al. A molecular marker of artemisinin-resistant Plasmodium falciparum malaria. Nature. 2014;505:50–5.

    Article  PubMed  Google Scholar 

  32. Huckaby AC, Granum CS, Carey MA, Szlachta K, Al-Barghouthi B, Wang Y-H, et al. Complex DNA structures trigger copy number variation across the Plasmodium falciparum genome. Nucleic Acids Res. 2019;47:1615–27.

    Article  CAS  PubMed  Google Scholar 

  33. Heinberg A, Siu E, Stern C, Lawrence EA, Ferdig MT, Deitsch KW, et al. Direct evidence for the adaptive role of copy number variation on antifolate susceptibility in Plasmodium falciparum. Mol Microbiol. 2013;88:702–12.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Anderson TJC, Patel J, Ferdig MT. Gene copy number and malaria biology. Trends Parasitol. 2009;25:336–43.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  35. Guler JL, Freeman DL, Ahyong V, Patrapuvich R, White J, Gujjar R, et al. Asexual populations of the human malaria parasite, Plasmodium falciparum, use a two-step genomic strategy to acquire accurate, beneficial DNA amplifications. PLoS Pathog. 2013;9: e1003375.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Huntley BJ. Angola in outline: physiography, climate and patterns of biodiversity. Biodiversity of Angola. Cham: Springer International Publishing; 2019. p. 15–42.

  37. Figueiredo P, Benchimol C, Lopes D, Bernardino L, do Rosário VE, Varandas L, et al. Prevalence of pfmdr1, pfcrt, pfdhfr and pfdhps mutations associated with drug resistance, in Luanda, Angola. Malar J. 2008;7:236.

  38. Rosanas-Urgell A, Mueller D, Betuela I, Barnadas C, Iga J, Zimmerman PA, et al. Comparison of diagnostic methods for the detection and quantification of the four sympatric Plasmodium species in field samples from Papua New Guinea. Malar J. 2010;9:361.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  39. Ansbro MR, Jacob CG, Amato R, Kekre M, Amaratunga C, Sreng S, et al. Development of copy number assays for detection and surveillance of piperaquine resistance associated plasmepsin 2/3 copy number variation in Plasmodium falciparum. Malar J. 2020;19:181.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  40. Beghain J, Langlois A-C, Legrand E, Grange L, Khim N, Witkowski B, et al. Plasmodium copy number variation scan: gene copy numbers evaluation in haploid genomes. Malar J. 2016;15:206.

    Article  PubMed  PubMed Central  Google Scholar 

  41. Nkhoma SC, Ahmed AOA, Zaman S, Porier D, Baker Z, Stedman TT. Dissection of haplotype-specific drug response phenotypes in multiclonal malaria isolates. Int J Parasitol Drugs Drug Resist. 2021;15:152–61.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  42. Brown N, da Silva C, Webb C, Matias D, Dias B, Cancio B, et al. Antimalarial resistance risk in Mozambique detected by a novel quadruplex droplet digital PCR assay. Antimicrob Agents Chemother. 2024;68: e0034624.

    Article  PubMed  Google Scholar 

  43. Chugh M, Scheurer C, Sax S, Bilsland E, van Schalkwyk DA, Wicht KJ, et al. Identification and deconvolution of cross-resistance signals from antimalarial compounds using multidrug-resistant Plasmodium falciparum strains. Antimicrob Agents Chemother. 2015;59:1110–8.

    Article  PubMed  PubMed Central  Google Scholar 

  44. Gadalla NB, Adam I, Elzaki S-E, Bashir S, Mukhtar I, Oguike M, et al. Increased pfmdr1 copy number and sequence polymorphisms in Plasmodium falciparum isolates from Sudanese malaria patients treated with artemether-lumefantrine. Antimicrob Agents Chemother. 2011;55:5408–11.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  45. Leroy D, Macintyre F, Adoke Y, Ouoba S, Barry A, Mombo-Ngoma G, et al. African isolates show a high proportion of multiple copies of the Plasmodium falciparum plasmepsin-2 gene, a piperaquine resistance marker. Malar J. 2019;18:126.

    Article  PubMed  PubMed Central  Google Scholar 

  46. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25:402–8.

    Article  CAS  PubMed  Google Scholar 

  47. Nguetse CN, Adegnika AA, Agbenyega T, Ogutu BR, Krishna S, Kremsner PG, et al. Molecular markers of anti-malarial drug resistance in Central, West and East African children with severe malaria. Malar J. 2017;16:217.

    Article  PubMed  PubMed Central  Google Scholar 

  48. Witkowski B, Nicolau M-L, Soh PN, Iriart X, Menard S, Alvarez M, et al. Plasmodium falciparum isolates with increased pfmdr1 copy number circulate in West Africa. Antimicrob Agents Chemother. 2010;54:3049–51.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  49. Plucinski MM, Talundzic E, Morton L, Dimbu PR, Macaia AP, Fortes F, et al. Efficacy of artemether-lumefantrine and dihydroartemisinin-piperaquine for treatment of uncomplicated malaria in children in Zaire and Uíge Provinces. Angola Antimicrob Agents Chemother. 2015;59:437–43.

    Article  PubMed  Google Scholar 

  50. Davlantes E, Dimbu PR, Ferreira CM, Florinda Joao M, Pode D, Félix J, et al. Efficacy and safety of artemether–lumefantrine, artesunate–amodiaquine, and dihydroartemisinin–piperaquine for the treatment of uncomplicated Plasmodium falciparum malaria in three provinces in Angola, 2017. Malar J. 2018;17:144.

    Article  PubMed  PubMed Central  Google Scholar 

  51. Ljolje D, Dimbu PR, Kelley J, Goldman I, Nace D, Macaia A, et al. Prevalence of molecular markers of artemisinin and lumefantrine resistance among patients with uncomplicated Plasmodium falciparum malaria in three provinces in Angola, 2015. Malar J. 2018;17:84.

    Article  PubMed  PubMed Central  Google Scholar 

  52. Kiaco K, Teixeira J, Machado M, do Rosário V, Lopes D. Evaluation of artemether-lumefantrine efficacy in the treatment of uncomplicated malaria and its association with pfmdr1, pfatpase6 and K13-propeller polymorphisms in Luanda, Angola. Malar J. 2015;14:504.

  53. Asua V, Vinden J, Conrad MD, Legac J, Kigozi SP, Kamya MR, et al. Changing molecular markers of antimalarial drug sensitivity across Uganda. Antimicrob Agents Chemother. 2019;63.

  54. Mvumbi DM, Bobanga TL, Kayembe J-MN, Mvumbi GL, Situakibanza HN-T, Benoit-Vical F, et al. Molecular surveillance of Plasmodium falciparum resistance to artemisinin-based combination therapies in the Democratic Republic of Congo. PLoS One. 2017;12:e0179142.

  55. Gil JP, Krishna S. pfmdr1 (Plasmodium falciparum multidrug drug resistance gene 1): a pivotal factor in malaria resistance to artemisinin combination therapies. Expert Rev Anti Infect Ther. 2017;15:527–43.

    Article  CAS  PubMed  Google Scholar 

  56. Gupta H, Macete E, Bulo H, Salvador C, Warsame M, Carvalho E, et al. Drug-resistant polymorphisms and copy numbers in Plasmodium falciparum, Mozambique, 2015. Emerg Infect Dis. 2017;24:40–8.

    Article  Google Scholar 

  57. Gupta H, Galatas B, Chidimatembue A, Huijben S, Cisteró P, Matambisso G, et al. Effect of mass dihydroartemisinin–piperaquine administration in southern Mozambique on the carriage of molecular markers of antimalarial resistance. PLoS ONE. 2020;15: e0240174.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  58. Wakoli DM, Ondigo BN, Ochora DO, Amwoma JG, Okore W, Mwakio EW, et al. Impact of parasite genomic dynamics on the sensitivity of Plasmodium falciparum isolates to piperaquine and other antimalarial drugs. BMC Med. 2022;20:448.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  59. Agrawal S, Moser KA, Morton L, Cummings MP, Parihar A, Dwivedi A, et al. Association of a novel mutation in the Plasmodium falciparum chloroquine resistance transporter with decreased piperaquine sensitivity. J Infect Dis. 2017;216:468–76.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  60. Kane J, Li X, Kumar S, Button-Simons KA, Vendrely Brenneman KM, Dahlhoff H, et al. A Plasmodium falciparum genetic cross reveals the contributions of pfcrt and plasmepsin II/III to piperaquine drug resistance. mBio. 2024;15:e0080524

  61. Rottmann M, McNamara C, Yeung BKS, Lee MCS, Zou B, Russell B, et al. Spiroindolones, a potent compound class for the treatment of malaria. Science. 2010;329:1175–80.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  62. Thaithong S, Ranford-Cartwright LC, Siripoon N, Harnyuttanakorn P, Kanchanakhan NS, Seugorn A, et al. Plasmodium falciparum: gene mutations and amplification of dihydrofolate reductase genes in parasites grown in vitro in presence of pyrimethamine. Exp Parasitol. 2001;98:59–70.

    Article  CAS  PubMed  Google Scholar 

  63. Phillips MA, Lotharius J, Marsh K, White J, Dayan A, White KL, et al. A long-duration dihydroorotate dehydrogenase inhibitor (DSM265) for prevention and treatment of malaria. Sci Transl Med. 2015;7:296ra111.

  64. Conrad DF, Hurles ME. The population genetics of structural variation. Nat Genet. 2007;39:S30–6.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

DNA from IPC_6261—kindly provided by Dr. Pedro Ferreira, University of Minho School of Medicine, University of Minho).

Funding

This research was partially supported by Fundação para a Ciência e a Tecnologia GHTMUID/04413/2020 and LA-REAL—LA/P/0117/2020; Denise Duarte is the recipient of the FCT grant 2022.12736. BD.

Author information

Authors and Affiliations

  1. Global Health and Tropical Medicine, GHTM, Associate Laboratory in Translation and Innovation Towards Global Health, LA-REAL, Instituto de Higiene e Medicina Tropical, IHMT, Universidade NOVA de Lisboa, UNL, Rua da Junqueira 100, 1349-008, Lisbon, Portugal

    Denise Duarte, Luis Varandas & Fatima Nogueira

  2. Faculdade de Medicina, Universidade Agostinho Neto, Rua Principal da Camama, Distrito da Cidade Universitária CP 815, Luanda, Angola

    Francisco Manuel & Maria Lina Antunes

  3. Laboratório de Microbiologia Clínica e Biologia Molecular, Serviço de Patologia Clínica, Centro Hospitalar Lisboa Ocidental (CHLO), Rua da Junqueira 126, 1349-019, Lisbon, Portugal

    Ana Dias

  4. Hospital Central de Lubango Dr. António Agostinho Neto (HCL), Avenida Dr. António Agostinho Neto, Bairro Cdte Cowboy, Lubango, Angola

    Esmeralda Sacato, Elsa Taleingue, Elsa Daniel, Francisco Simão & Maria Lina Antunes

Authors
  1. Denise Duarte
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Francisco Manuel
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Ana Dias
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Esmeralda Sacato
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Elsa Taleingue
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Elsa Daniel
    View author publications

    You can also search for this author inPubMed Google Scholar

  7. Francisco Simão
    View author publications

    You can also search for this author inPubMed Google Scholar

  8. Luis Varandas
    View author publications

    You can also search for this author inPubMed Google Scholar

  9. Maria Lina Antunes
    View author publications

    You can also search for this author inPubMed Google Scholar

  10. Fatima Nogueira
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

D.D. processed samples and prepared the original draft of the text; A.D. analyzed data; F.M., E.S., E.T., E.D, F.S. sample collection and processing; L.V. patient enrrolment supervision and manuscript revision; M.L.A. designed the research study and patient enrrolment supervision; F.N. designed the research study, sample processing supervision, curated the data and edited the final text; All authors reviewed the manuscript.

Corresponding author

Correspondence to Fatima Nogueira.

Ethics declarations

Ethics approval and consent to participate

DNA samples were collected following individual oral consent and signed informed written consent from all participants or their guardians. Ethical clearance for the work was obtained from: Comité de Ética Independente da Faculdade de Medicina da Universidade Agostinho Neto and by the Hospital Central Dr. António Agostinho Neto (HCL) institutional ethics review committee (deliberation Nº08/2020, on 14 November 2020).

Competing interests

The authors declare no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Duarte, D., Manuel, F., Dias, A. et al. Low prevalence of copy number variation in pfmdr1 and pfpm2 in Plasmodium falciparum isolates from southern Angola. Malar J 24, 5 (2025). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12936-024-05240-2

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12936-024-05240-2

Keywords

Malaria Journal

ISSN: 1475-2875

Contact us